Circhmgcs1/mir-335-5p/itgb2
WebCircRIP was performed in QBC939 cells using circHMGCS1-016 and negative control probes, and we found a specific enrichment of circHMGCS1-016 and miR-1236-3p compared with the negative control; B ... WebMature sequence hsa-miR-335-5p Accession: MIMAT0000765: Previous IDs: hsa-miR-335: Sequence: 16 - ucaagagcaauaacgaaaaaugu - 38 Get sequence: Deep sequencing: 416898 reads, 152 experiments: Evidence: experimental; cloned [3-4] Database links: RNAcentral:URS0000237AF9_9606; Predicted targets:
Circhmgcs1/mir-335-5p/itgb2
Did you know?
WebJan 1, 2024 · We found that SC dramatically promoted cell apoptosis and induced G0/G1 phase arrest in PCa cell lines via the circHMGCS1-miR-205–5p-ErBB3 axis. In brief, … WebOct 8, 2024 · CircCRIM1 was found to be a competitive endogenous RNA that sponged miR-455-3p and regulated angiogenesis-related phenotypes in MAECs. Furthermore, …
WebDec 20, 2024 · Differential expression of microRNA (miR)‑335‑5p, a key tumor suppressor, has been detected in pre‑eclampsia (PE) placentas. However, the role of miR‑335‑5p in the pathogenesis of PE and the factor modulating its aberrant expression remain unknown. The present study used JEG‑3 cells in vitro to investigate these mechanisms. The role of … WebOct 21, 2024 · Over-expression of miR-335-5p inhibits NSCLC cell motility and migration and invasion. a-b Transwell assay of the cell migratory and invasive activity in A549 and …
WebDec 1, 2024 · AKT3 acted as a target for miR-212-5p in TNBC cells. (A) The binding sites between AKT3 and miR-212-5p were predicted by online bioinformatics Targetscan. (B) … WebThis study aims to explore the regulatory mechanism of circHMGCS1/microRNA-503-5p (miR-503-5p) axis during colorectal cancer (CRC) development and progression. Real …
WebThe shcircHMGCS1–016, circHMGCS1–016, shmiR-1236-5p, miR-1236-5p, shCD73 and shGAL-8 lentiviral vectors were obtained from Genomeditech company (Shanghai, …
WebNov 1, 2024 · 1 Overview. miRBaseConverter is an R/Bioconductor package for converting and retrieving the definition of miRNAs ( Names, Accessions, Sequences, Families and others) in different miRBase versions ( From miRBase version 6 to version 22 [ The latest version ] ). A tiny built-in database is embedded in the miRBaseConverter R package for … ripped blue denim jeansWeb(b) NC mimic and miR-205-5p mimic were transfected into GC cells by using Lipofectamine 2000 and transfection efficiencies were detected by qRT-PCR. ∗∗∗p <0.001 vs. GES-1 or NC mimic. tempus labs valuationWebSep 15, 2024 · The shcircHMGCS1–016, circHMGCS1–016, shmiR-1236-5p, miR-1236-5p, shCD73 and shGAL-8 lentiviral vectors were obtained from Genomeditech company (Shanghai, China). The circHMGCS1–016 shRNA-1 target sequence is 5′-ATAGCAACTGAGGGCTTCGTG-3′ and the shRNA-2 target sequence is 5′ … tempus marvelWebMar 21, 2024 · MiR-17-5p is a predictive factor for chemotherapy response and a prognostic factor for overall survival in CRC, which is due to its regulation of PTEN expression. Our results indicated that paclitaxel resistance of lung cancer is associated with downregulation of miR-17-5p expression which might cause upregulation of BECN1 expression. tempus mission statementWebOct 21, 2024 · Background: Significant evidence has shown that the miRNA pathway is an important component in the downstream signaling cascades of TGF-β1 pathway. Our … ripped jeans kim kardashian 2014WebJan 1, 2024 · An RNA fluorescence in situ hybridization assay was used to assess the co-localization of circHMGCS1 and miR-205–5p in PCa cell lines (I). After treatment with circHMGCS1 OE, miR-205–5p mimic, or circHMGCS1 OE combined with miR-205–5p mimic, the proliferation (J) and colony formation (K) of PC3 and DU145 cells were … ripped black jeans diyWebJul 3, 2024 · Additional file 3: Decrease in miR-335-5p expression in NSCLC tissues and cell lines and the associated with biological processes and signaling pathways.(a) miR-335-5p expression was significantly decreased in NSCLC. Fold change > 2 or < 0.5 and ii) False discovery rate (FDR) < 0.05 and P < 0.005. Each row represents individual miRNAs, and … tempus linguistik